Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y71H2_388.c   

sjj_Y71H2_388.c RNAi JA:Y71H2_388.c
Simmer:Y71H2_388.c
PCR_productsjj_Y71H2_388.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y71H2AM.20 Source_evidenceePCR196WS150 Sequence/Annotation Release
Chunk_score Abs_score154
Specificity_index0.177
Rel_score0.431
Map_statusBottom50_percentile_ePCRIII27856952786700
Y71H2AM.4 Source_evidenceePCR399WS150 Sequence/Annotation Release
Chunk_score Abs_score357
Specificity_index0.411
Rel_score1
Map_statusTop50_percentile_ePCRIII27856952786700
Y71H2AM.5 Source_evidenceePCR484WS150 Sequence/Annotation Release
Chunk_score Abs_score421
Max_abs_score421Y71H2AM.5
Specificity_index0.411
Map_statusBest_ePCRIII27856952786700
Overlaps_transcript (6)
WB_DNA_textsjj_Y71H2_388.c1006gcatgtcgataaagctgataaccaagtctgtgcatctcatgtctgcagttgtatgaactccaactacagaatcattcaaacgatgcaagaaagccaggtactcctcgtaagcctgcaaatttccattcataatccttcaaatcgataaaatttctgttctaccttggaaaagtaccacggattcaggtcgaacacatttttaatcatcttttccggcggtttatacgagttttcagccatttttctggaaaaaaatctatttgttttgatttctagaactttgttatgtaaaaaaataatgcagcaagtgcgctccaacgcaaaaccccattgtggagcgttttgtgcgtgagaggtgtataggagtgtgtggctcgcgcagcgtctttagtgaaaaatttttattgattttaaatattgtttaattcggttttcacggatttctgagctttgaaaataaccgcccgtgtttaaatttcaattatattcaatttcagtaatgcctgtcgaagttgaggttcccccaaccacttacgagagactccagcaatacaaggtgaatttttagcgtttttcttcatttttatcgataaaaatttacaggagaagttctccgatgctctccgtcatccagactcgccagactggtacaagaaggagacccacgagtctgtgaagaaggatcttctctgggctgctccatacgacgccagattcccacaggttggtaactttatttaaaatttattatatattaattaataataaaaatgtacaagttttcaggtccgtaagcaacgtcaatgcttcgcctactacgtcgatttccatcgttgcaatgagctcatgggacaggactacaagccgtgcaagttcttccaaaatgtctacaaggacttctgccccggattctggaccgagagatgggacgagcttctttccgagggacgtttcccagctaaattcgatcgctaaatgagattgttcgattgtattcgagaacagg