Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y76G2A.2   

sjj_Y76G2A.2RNAiJA:Y76G2A.2
PCR_productsjj_Y76G2A.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY76G2A.2 Source_evidenceePCR240WS150 Sequence/Annotation Release
Overlaps_Gene Y76G2A.2 Source_evidenceePCR240WS150 Sequence/Annotation Release
Chunk_score Abs_score177
Specificity_index0.406
Rel_score0.894
Map_statusUnique_ePCRI59767745979435
C06A5.10 Chunk_score Abs_score198
Max_abs_score198C06A5.10
Specificity_index0.454
Rel_score1
F14D2.4 Chunk_score Abs_score61
Specificity_index0.14
Rel_score0.308
Overlaps_transcriptY76G2A.2 Source_evidenceePCR240WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y76G2A.22662aaataggatgcttcatacgcaaacgccaaagtacgcaaacaccgaccgtataccgtattcatcgaaacgaattaaatttttgcaacatctatttttcagctcgaactgttaaattttgcttgaaatgaaggaaataatgacgaattttgttataaaacacattataaaaaatttagaaacatataatcatgacaaaaaaacaatatccggaggaaatttgattaggcctaaaatttatttgtatttgttccatttttcgatataatattaacattttgttcaactttctggttcaaaatacagagaaacacacgatggacatgaaatgatcacttttcaggaaatattttagaccagatacgtctatttcgatccaggatacaaggaacaggcagctttcatgattttctatgctcaaaaaattaaaagaccctatgctcaacttgaaaaaccagctgaaggatcagaccatcaggaggtacccttacgatccttcttatctgaaggatcagatcatcagaaggtacccatgtgatccttcggagctgaaggttcagaacatcaggcagagcctcatgttcttttagagctgaaggatcagaacatcaggaagagcctcgtgatcctttggagctaaaggatcagaccatcagaaggtacccttacgatccttcttatctgaaggatcagatcatcagaaggtacccatgtgatccttcggagctgaaggttcagaccatcaggaagagcttcacgatattccaagttagttggacgttttacagcttttcccaaaagaccatcgttcatacattcaattgtgagggaattataaccgaaaatcgattgaaaattgcattaaaaaacttattccagaaaaatgtgaacaaaaattagttgaaaaatacatataaaaatctagttgaaaaaaaggttgtcaccaaagatatgccccccaagatacaccccagtttgtctactggatactttgcccccaaagaacctttgccaccctaaaagtttatcatctcggaatgaaggcctggaaaaagtttatggtggttttttttaacttttgcgactgatcgcgacttctttctcatacgagacgagctcgtttatgaaactgatttttaaaaaattttaaaagaaaacgacacaattcgagaaaaataatttcattgaaaaatgcagcaaaacttcagcaaaaaatctaccatagcctcttttgcgcaccgagacccatttgaataaatccgtgcgccaataagaaggcctcccaaaagatggggaaagtacgataatttaattataattgttcataaattttcttcgttttaattcaactttatcattttttttaaactaatttaaatagatatcatttcataattttgtgttagcgtgtaaaataactagacctcccaaaaactttactaataaaaactttgaaaacttaagtcaggtggaaaaatattttcaaacgtgaggtgagtgaatgaatgagcaaatattggttgacgagttagaagaatattttgaaatttcaacaaatgaattctgttcacgtgaatgaattcaatgttgtttaggttctcggggcagaaaaataaagttcttcaaactgtaagaatttaagtagcttaaaactaaatttgcaggatgtgaaaagttgttaaaagtcaatcaatcaaatgtcaaatgtgtgatccgtgtagtcgtttcgacaaggaagatgatgggggaagagagaaagagaggaagaacctgaaatatgagtagatggcacctcggtgagataaaaagctgcaaagcaccgaaggagcaccacgctgtgataacatgtcgtcagagccgtctccgaaaatctcacttattgtttttgttacaatgaaaatcgggagaatttttattaagcattccgaatcagctagataatcggtgttcataagtttatctcagatctttatgaaaaatagttaagaacaacactgttcttctgaaagcacaacaaggaactatgtattacatgtaatggggttattcaagtagtgtcggaaaattaaaaagtgtatttaaatacatattttgccttattcaagtaacaataaaaacatgtatttaaatacatttgtgacgtaatttttcgacatttttcgacattttcctacacttttttacagtagtaaaaaatcgcgaaaagcgctcgaaatggacaatcgcggcgggacccattcgatgaaaagtcggtgtccctttaacaatcgatattgcggaggcctttttcagggattttttcgattttttcatatatttcgtttgtttctctttaaaatcagttataaaaaaattaaatattgagttcttctttcagaatacaagcgatttttaccaaaattataggtttttactgccaaaattagcgaaaatgtctgaaatacttcattttacaattttacccacttgattcttgtttcattctgttttattttgaagaaaaacttattttaattcaaaaaacttttcagtaatcgtcccaatcaacaagctcactcttcaacagttcgagatgctcaacacgtgtgctcaatatgttcaaacgggatcacagaagctcactcgagaagctaactacgttatcacggaggttaggttgttttaa