Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y77E11A_3443.p   

sjj_Y77E11A_3443.p RNAi JA:Y77E11A_3443.p
Simmer:Y77E11A_3443.p
PCR_productsjj_Y77E11A_3443.p
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (3)
Overlaps_Gene Y77E11A.7 Source_evidenceePCR602WS150 Sequence/Annotation Release
Chunk_score Abs_score523
Max_abs_score523Y77E11A.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV14173821418759
Overlaps_transcript Y77E11A.7a Source_evidenceePCR557WS150 Sequence/Annotation Release
Y77E11A.7c Source_evidenceePCR557WS150 Sequence/Annotation Release
Y77E11A.7b Source_evidenceePCR602WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y77E11A_3443.p1378tgtcatttttgggtgaaaaattcaattttcggtatattttttttcttcattctttttgaaattttagaatgaaaaaaaaaaccatttttgggtgaaaaatccttttttgtaatttcagtatgaaaaatgtcatttttttcggtaaaaaatatgactttaggtaatttttgtaatgaaatttccttttttttttcggttaaaaatccatttttttgccattagcctgaaaaatgctattttttaggtaaaaaccccgattttaggtcaatttttgtgtgaaattttcaaatttttcggttaaaaactgcatttccaccgcacctttttgcaaattctattctccatattcgaataataccaattcaacacataatgtgcagtttcggcagttcttctcgacgttttcacatgatttccctctatttccacaaaaattttcttcttcgagctcgtcgatttgccacgattccacaaataactatcaatataataatcggtattttttagtccgtgacggggttcaacaaggaaattctgaggccctttacgtgtttcatcgattgtcaacgggaattctttctgaacttcatgttcttcgtagcaacggaaataaaggaaatgggcagctttgttgggaattgagagatccgaagatttgagattgagagtttctccggtgaatgaggtggctgcggcgacacgctgcaaaacttttttgagacggtttttgctggttttttagaggatttctgtgcaaaaattggggttttttttctgtgattttagacgctttctgaaggcttttcgcaggtatttgaaagtgagttttcggaattttagggcattattttggctctttttaagcagctttttacagtgaattttctgtgaaatttcggctatttctggtcgatttttgatcgttttcagagcatttgaaactttactttgccatttttagtggattctcgttttaggtgtggtttttgctcattttcacaggatttttcaagtaaaaatcctcatttttcagggtttttttcggtgaaaaaatgccattttccgcgataaatcacctgcattgtggtgacgaggtgttcgtcttcattttgatacggtacctttctagtcggagtcggacgcccttgatatttcattgatgatattgtaacctcatttgcaaccgaaaaatcactgtttaagaccatttgagcgtcgattttctcgcgtttcaaagccatttccatttcaatttccattgtttgagtgtccatgtgatcgtcgagcactgacgcgtctggaaattgagaatttttgagattttaggggtttttcaattaaaatttggcctttttcgggaagttttagcttcaaaaat