Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y87G2A.f   

sjj_Y87G2A.f RNAi JA:Y87G2A.f
Simmer:Y87G2A.f:Screen_A
Simmer:Y87G2A.f:Screen_B
PCR_productsjj_Y87G2A.f
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY87G2A.1 Source_evidenceePCR338WS150 Sequence/Annotation Release
Overlaps_Gene Y87G2A.1 Source_evidenceePCR338WS150 Sequence/Annotation Release
Chunk_score Abs_score317
Max_abs_score317Y87G2A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1352428313524854
Overlaps_transcriptY87G2A.1 Source_evidenceePCR338WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y87G2A.f572atttgtgtagtttttgaagcggatttttaaaaagagttttgtagtttatagacacatgctcgaccacaaactacaaaaaaaaacactacaaactacaaactacaaccctatctattttccaggatatatacacattcaacgcagtctgtaaagttgaagatatgtgtatgtcacttttgaatcgcctccaagattgtcaaaatccacgtgtcgccctcggatatcgagagaaaattgcggcgatcgttcgtaaatcgacaacggatccgggattgtgtgacgagaaaagtgtagaggaaattgaaaagtcatgggtacttcagaaaccgattagaggacgtcccaggaagagggtgaagctggaaaatggacaagaagacggtggaggagatttggatgaagatgatgatgttgtaatggatgattatgaagatggagaggagaatggggataagaagatgtatgtgtgtgaaaatgtgtagtttgtagttatatcacattttatttagaaaaaaattacaaatttccactgaaattttacgttaaaaatcataaaaatccgagaaaaatgg