Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y87G2A.w   

sjj_Y87G2A.wRNAiJA:Y87G2A.w
PCR_productsjj_Y87G2A.w
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y6B3A.1 Source_evidenceePCR175WS150 Sequence/Annotation Release
Chunk_score Abs_score175
Specificity_index0.184
Rel_score0.226
Map_statusBottom50_percentile_ePCRI1360174313604061
Y87G2A.13 Source_evidenceePCR883WS150 Sequence/Annotation Release
Chunk_score Abs_score778
Max_abs_score778Y87G2A.13
Specificity_index0.816
Rel_score1
Map_statusBest_ePCRI1360174313604061
Overlaps_transcript Y6B3A.1a Source_evidenceePCR175WS150 Sequence/Annotation Release
Y87G2A.13.1 Source_evidenceePCR883WS150 Sequence/Annotation Release
Y87G2A.13.2 Source_evidenceePCR881WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y87G2A.w2319accaatggttttgagtatgatgccaaaatgaatgcgggcaacaaaaaagcgacgtgatccagcgattttttaattcttccatcattttccaacgccttcagatacataattgcacatcggaaatttgggaaaactagcatcgcggagagcattgagaagaatactgatagggagatgtacctgaaagatttttagtttttttacaaacatttttttgaaaagttacatcatcaatggattcgttggccgatagtcacgaatatttgcagtggagttatcgaagagtccagagctttccacgaaatccgcaatatttgtactcaatttgtcgtaggcttcgagcatttgaatatcaaaaatgcgatgtgaattcattgcaaaaatgaacgaaaacaagaaatatagacatccaatggaaatcatgaatcctcgttcatcgacacttgaaaccaaatacgaagagagtgcagtaagtacttgaagtacaaacataatgacaacaagcatgaacacaattgacacgttgaagtcacgattgtcaggcattatgtagttgtagacttctgatagtgtgtagacgaataggcatacaggaatacacaggcagagccaatgaagtgatgtgtacatttcaaattggacgagatctttcacgtcgactggatagaggttcaattggaatggtgaggattttggtagggagaatccttcggcggcttcgtcttctctgcaaaaatagggaatgaattgatagggaagatcactataataatactttattactatattaattaataacactatattaactaatattaataatgtaataatgcacattatatttcctcgattaaaggaacctcgcttttacagattttttctaatctcatttccagattggataactatgaattgcatgaatactgaattttatgtacgttactgattatgttctattcgaattttaatcttctaacacgatttactaaatcttatcatattagtattgcaccctatattttaaattcgacagctgttctcatctgtcttattttttaaaaaattggcaaccgaccaaatacgtgatagttctttctctaccgtttgtagttaactacatattgatataatcaatagagatataatatagccaagtaaggtagtcatgtgcaatactaatagaggaagtatgatattttattacatactatctaattacgttaatatcgtattgcaaaactgtgtttgaaaattctccgaatttttaacttttgtacatttatcaatttatctgaaattttgacatttataatggtattaatactatttctattatacaaaatgcttcttttctcggacttttcattcatttttcccatcctaaatacctcttcttccgacgatttctctgattcattttctccttagtcggtggcagcaatgctttgagttcttgattcgatggtgccaagaatcgatagagtctggaatttataaactaatttttttcgcaatttcaacctcgaaattacccattcgtcacaaaaatatcgataaaattagcgcggcgcaccaattttgatatcaaagtgattgccaccaggcatatcaccacgtggaatcccagtattgccatctgaaagagcgggagaatgtagtttgtagtatgcacaactatttttttgtagtttgtagtttttgagcagatttttttgaaagtcaaaatttctaaaaatttccgtaaaaactgggaaattttgcgactcaaccaagataaaacaatttggtgaggctagaactacaaactacaagatttggtgagcctcaaccaaaaattttttttgttgaggctcacactacaaactacacgaatttctgagcctcaaccaaatttttttggtgaggctaaaactacgaactacacgaatctctgagcctcaaccatattttttttataatttgatattgattttaaatacaatttccgaatcaaaatttgaataacttcgttccaaaatgttaaaatggatatttttagttgaggctcacgctacaaactacaaaaaaagtaattttcaccgaaaaagatactttaaaatggcattttcaaccagaaaaatggataaattaaaaaataacatcttcaaaatttcaaaaactattgttgtttcataataaataagggaaaagagcacaaagaaaaaccgtagagccatatctggaaataatttaagtctaaaaaagggggatgcgggggaggaaaaaaaaaatcaatatcacaataaacgaaaaaaaaagtagagaattatttgacggggg