Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y8G1A.2   

sjj_Y8G1A.2 RNAi JA:Y8G1A.2
Simmer:Y8G1A.2:Repeat_a
Simmer:Y8G1A.2:Screen_B
PCR_productsjj_Y8G1A.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY8G1A.2 Source_evidenceePCR713WS150 Sequence/Annotation Release
Overlaps_Gene Y8G1A.2 Source_evidenceePCR729WS150 Sequence/Annotation Release
Chunk_score Abs_score645
Max_abs_score645Y8G1A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI37514263753923
Overlaps_transcriptY8G1A.2 Source_evidenceePCR729WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y8G1A.22498tgctgtcacctacattcattcacctccttttagaaaaaaaaacccccagagagggccctacacgcatttgacctcgaagataccaatcgagatatgacttctttttcttgagaaatttatctaccttgggaagtgaccgctctcctcccattcacgcccattcagaatgtcggagaggattccaagaccccagaaggtgtaggaagtgccgaggaagctgaaaatatggagaaagttgctcggggagctggatagagagatttcagaagctttttgactttgattgtgccaaaatttcaaaacaaaaacaaaacacttacttgttgagaatgatgaattggaagacgatttgaactaagtagaggaacttgacaaataggtacaagtaggtaaggtagctgcctccgtaggtgaatgcagatgctgaaagtaaatagaagctgaggtgtccagaaatcctctcccactaggggctcctaggctatcactgaatcagttgttcttatactcaagattactgtcaattctaagatacatctaacggttttgatctatgggtgccagaggtttctacacctttcacatcatctctagtctgctaaaaaattactgaggttttctaatccacttctaccattttccattcaaggattctagggcacgtctgattcagtttattctctttctagcgatgatccaggttacgtttttgttcaaaatcccttaccaaaaaaaaatttcctcaagaaaccatctgtttcccaaaaacaaatccaatttctctctctcttcaaatttttaaccccattatctccttacaggcataccattctcctcatctcgctctctttctcctgcctcccggcaaggtcaattacaagtcgagtgaggaaattagaaaacataaatttgggatgcaacatcaaacgtttttttttgttgatgttgtgatgtaaggtggaggccagattaggaaaggcaaaatgggaatttagcccgaaagttagtttagaggtttctaggccatgtatgacgtcactgctcttccacgtgccatcacatagtattctaggatagtcaagattgttccataagtagaccaaaatacttctagatcaagtatgaagttattatttgttctagcaggatcgccaatgcttctagaccatatttaatatttctaggccatatgtgacgtcacttatttttacacaagactgaagaagttctacaataaagcatgaggttgtctaggtcaactcacataatatttatatccctagcttctctaactgtaactgattctgaaacccatgtaatcacaattgaaatttattgattttttgaacttcaatcttgaaaagtcgcaaattctgatttgtttagtttaaccctcctctagacacttgtctcccgtaaatggaagtttgcaacagtatttgatcaaccctcaaattcaaagaccatatgtgtttcccttttgacacgagaataaaaactaaaactaaaaaccagttctccttccctcaattgtttcctcttcttccggatcatcaaccgcgcctttctgctgggggcatgatggcggctaattgaaagatgtacgaagacaaatgtgttgggaaaaacagtttctttgatgaaatttgcaaaaactaaactcactgtatttagcgaaacgagattgaagagtaagagattcgtaaagatgagctccagttgatttggcagcttcgttacgggccttctcatcgactcggtcagcttttttggctccgaagagcattttcttgagagcaactcctgagttgaagttcataagtcgccagaaaagagatggaagatagaagaggatggcttgaagtccgaggatgaagggtacccactggtaatatccaatttcagcgccttctctatcgatttcagagtctgggatgtacttgtcgggactgatgaagtatgtgttttgcacgaagcaatagttctcactgtattgctcccaagcgcctgaaaaatttcaatataggagtgcactagctgtactattattgtctgaaaatttggaaaggggctgcagaacttaggacggcattttttatttcagcctacatgtctgtctgaaacctatccgtctgcaataatcatttctcccgaaggatagctggcaaacttatagtcacagtcttcttagaagcacccgacatctcacaggtcgaaataaaaataaacccgtgagatgtcgggcgcacttgtatgctaacaagcattaggcacgcaggtaggtacgaaatagcgtgattttcatacctgtgaactgagctggaatccaacattgaataggctgtccgacgtactgcttggcggaaagtgtcaacgcaaagatgacgagaagcataggtgtccagtaataattgagcctatcgatggaatcatcatcaccctgcttgtgcagacccttgaggaacgcgtccaagaagaacatcctatgctcggtatga