Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y95B8A_84.d   

sjj_Y95B8A_84.dRNAiJA:Y95B8A_84.d
PCR_productsjj_Y95B8A_84.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY95B8A.7 Source_evidenceePCR434WS150 Sequence/Annotation Release
Overlaps_Gene Y95B8A.7 Source_evidenceePCR434WS150 Sequence/Annotation Release
Chunk_score Abs_score413
Max_abs_score413Y95B8A.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI860996862034
Overlaps_transcriptY95B8A.7 Source_evidenceePCR434WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y95B8A_84.d1039aaattgagcatttctagttggcacattcaaatttttaggcgaaaaatttgatttcaaaatttcaaaatttttcagaatttttttttgctaaatgttcagatttttgtgcgcaaaaatatttgaaaaatccaaaaaaaaaactcgaaaattgagcattttcagttgtaaaattcaactttttaggcggaaaaatgtgcaatttttccccaaaaaattcaaattttccaacttttctctcaaatagcacagaaacagaaaatttgttatacctaatgtggaaaaactgaattaaaacagattttttgaaaaaatgcacttttttttttgccaaaaaatagttcaaaccccgactttttgttccagagtttccaggtcatcggtatcatcgcataaataaattttgcgggaaaaattcccgctttttttgtagatcaaaccgaaatgagacactttgacaccccacgttcagacaaaaccccgacttttttccagagtcatcggcatcaacacggtaaacttcgtcggcggtacgaagctcaactccaccggacaactcgaggagaagaagcgcgaagttgctgccgccgtgagctcagtcggccggaaaaccggtggtgctgctgcaacgacgacgattgaggtggaagacgagaagctccgagcaatgatcgccgccgaggaggtacaacctgtcggcgaggaacatgtcactgaagaacgtgatgctaccggaaaactggtgcaattccattgtaaactgtgcgattgcaagttctccgatccgaatgccaaggagattcatatcaaaggtcgtcgacatcgtgtcagctatcggcagaagattgatccgacgttggtggtggatgtgaagccatcgaacaaaagatcacaggagaagcggaagaatcagcttccagcagttcatggtgtgtggattttttaacaaaaaatcaacaacaacacaaaaaacatgttccaataaaattggaaaaaaaaatttaaaaaatcccaaatttccaggtgtctaaaaatctcatgc