Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC302.3   

sjj_ZC302.3RNAiJA:ZC302.3
PCR_productsjj_ZC302.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC302.3 Source_evidenceePCR711WS150 Sequence/Annotation Release
Overlaps_Gene ZC302.2 Source_evidenceePCR89WS150 Sequence/Annotation Release
Chunk_score Abs_score69
Specificity_index0.102
Rel_score0.114
Map_statusBottom50_percentile_ePCRV1074184210743471
ZC302.3 Source_evidenceePCR711WS150 Sequence/Annotation Release
Chunk_score Abs_score606
Max_abs_score606ZC302.3
Specificity_index0.898
Rel_score1
Map_statusBest_ePCRV1074184210743471
Overlaps_transcript ZC302.2a Source_evidenceePCR89WS150 Sequence/Annotation Release
ZC302.3 Source_evidenceePCR711WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC302.31630attcagatctcctcctcatcacattactaaatatttattcaaggaatatactatttctattttgtactatgttgacaataaatggctcaatgaactatcgattttcagttgttgtaggagccatgctccaatgttctctttgaattttgagtcgatctcattcagttcaccgatcactttccgaactcttttatcgtcctgaagttaaacatattcaaaatctagtaaaatgcaaagggcaattaccataaaaaactcgtaagcttctgctttcatagtggcatccttgatctttttcacaagttgtgatggagatcgagagtcgtttcgattcttaaaattctaagatttttagaataatttttcgacattcctaccgctttgtagtttagatactcagtttgtagagatacaacccgatccaaataaattagtgatcgttgttcataatgagaattggatgcggttttacgacaattccagtactctgaaaatagtgtttcttggttcaaaatgtttattatggagacgcagaaaaatgccccttttgaaatcgtgctccacggccacttcaataagttccgcccttgaaccattggtctcgttaggcattggcgggaaacccagaagttcaaacgttttcaattttttctctaatttcaagcgtttttcatcgttttgctatttttcccgttgtttctaatagtttttaggccgaaataatgttttaaagaaatgaaaatgcaaattgaaaaattgaaaaggtgaataaggtttttttgaaggaattatatttttcaccgttttgccattaaatacctaacgggatccatcattctgggggcagagcgttttcaattggctgtagagcgcgtttctatgaagaatggaagaagggttatctttgcgtccctataatataactcacgttgaaacatttgtttaatctctggaatatccatcaattccttctcgcttttccccaaaaatcttgcggcattcaacttgacagaatcttctactgatttagtaatcaacatatttttcaagacaacagtattaaccgtacattgtgatttcaatccatccagcattgacttgcttttttccaaagtttcatttgattttcttcgatattctctcattctagtagcattccacattttttgctcgtcctctgtcattatatgacctggtttttgccaaggaatctgagttgtcttcagatcatcaatcattgcaataaagtttcgatcgactggatgatgctataataattattttattttaaccaagatgacactgttctacaaaactacttctttttgtgtatttggtttaggatcagggagtggctgcatttgggcaaggagctcatgtgctctctgaaaaacattaatcattacattttcatgaagattcttcctctttttaaatattgattactctaaattttcacgttttgggaaatttggcaatttaccaaaactttgtctgcaacttttaaaacatctatgcatttttggagtatataattttgatatttagtatctagattctaaccacttcatacaacttgggcaattagtaatttcttcgccaactctagcaacttttggaataacgcata