Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC328.4   

sjj_ZC328.4RNAiJA:ZC328.4
PCR_productsjj_ZC328.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC328.4 Source_evidenceePCR870WS150 Sequence/Annotation Release
Overlaps_Gene ZC328.4 Source_evidenceePCR870WS150 Sequence/Annotation Release
Chunk_score Abs_score744
Max_abs_score744ZC328.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64075706408700
Overlaps_transcriptZC328.4 Source_evidenceePCR870WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC328.41131aacgaaacaatgatgacgcagaagatgattgggatcgatattcggaaaatgtccgcccaacaagaaggggaagaaagattgacgcactgaaaagagtaagtatggtattttcctagaaaaaaattttatctaaatttcagaatgttgaagaagttgttaccgaagaaactgcacgcttaaagcttgatcaacttctcgaagaacttcaaaacctggaatgttcagaagaaagcgaagaacttcagaaaattctagatttctgttcgtggtttgaagagaaacttgcaattggttttcacaaagtatattacgaacttctctggaaaataatcagcaggctagtttacaaaactgaaaaaaacaataaaatatattttagacatggattcctggagaaatacaaagaggacgagagaatgcttaaaatttgggagaaaatggcagataatagcgctggtcatgcacatgatatttatcagtttgctattagcagaaaatctttagtaaagtgagttctgatatttttcgtttaggaattttataaattgaaacaattttcaggtgcgctgctctctacgctcgttggtctcaatctgtggaactagctggtgcatacgtagaagccagacgtgttctgattcttgctcgaactaattgcgcagttccaatacaaatcgtcaatgatgccgaagatgctctagaaatgagagaaatgcgaagacatctacaggaaagagactctgatgatgatgaggaagaggaagaaacgagaaaagcattcactaatttaccaggtattttttgagtcatttgaaaattcaattgtgactaaattttcagtgattggtgataatcatacagttccgattgttcgtttgccatcgatgtgctcagatacaacgaagaaagcgatgaagtttgatacgggaaacgtggaaagggttaacccagtttgtaaggataatcaaatgcaaccatttgaggtatggttttttctagctaagtgagaaattctgcagttttatataaatattattttaaaaattaatatcgttcaggttctctcctacactgatgcggatgacgtggaatatttgagaaacgttcatgagcttcatgctcacatcgaaa