Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC434.4   

sjj_ZC434.4RNAiPF:GL1_2A9
PCR_productsjj_ZC434.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC434.4 Source_evidenceePCR777WS150 Sequence/Annotation Release
Overlaps_Gene ZC434.4 Source_evidenceePCR800WS150 Sequence/Annotation Release
Chunk_score Abs_score695
Max_abs_score695ZC434.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1033206810333192
Overlaps_transcriptZC434.4 Source_evidenceePCR800WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC434.41125cgtgatccgttttctgtcctcttcaaacttcttaaggagttcctgagcttctgaaacagatattttagttggattactgaaaatattgaaaacttactctcttgacgatttttcttaatttggaacgtgtaatatgcaagatcaacctttttcttcttgttatttaatccaccaataagaggaacatcctctttcttcagttttaccgattttgcagctttcttggctttagtaacagtaatccatccgtcctcgtctggctccgaatactttctcttcgcctcttttcttgcttctgtttgttctgtgtcatatctttcgacgtacgtatcggccatttcttgaatttgctcttcagatgggaacagtttgcgatagagagttgtagaatctgaaataaaacattatatccatgataaaaaaatttatgttcgttcagtgacgaaacaaaccttttagtacggaaggaaactcgggatcttcaagaaaatcagtgatcgtaaaaggtcctacgtcttggcatagtgccagagtttgaataactgcttcgggcttatcgaaagtgatggacattgtcaattgtccctgagaaagtgaattgtcagcggtgttgcttcgttgaacaaacgattcttcaacctcgaatgatgcaaactgatcaataatcgccagaaccacaccctgaaaattaaaattgaacgatggtcgtaattttttctcaagaaacctctccaacaaatgcgggaatattcgacacaatgattgagttctccttcgacggatcttttttcaaaaacatatgacgctctgccatatactttccaccaattcggaatctcaaatctgaaaacagaacaatactacaaaaaacgtaaagtgaattcgaacttacatcgtagcgcatcggggtccaaatgaattactttttcacttttccgtttagctacttttttaacgcgttttttcttgcaacaatccattgtctaaaaccttcaaacagactctagaataaaaaatatgtttaaatttaaaaaaaatgtatgttttaaaaaaatgttttaaaatatgttacaaagaaagaaaaataaattgtcgtgagtttgtgggctaagagttccgatgcac