Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC443.6   

sjj_ZC443.6RNAiJA:ZC443.6
PCR_productsjj_ZC443.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC443.6 Source_evidenceePCR868WS150 Sequence/Annotation Release
Overlaps_Gene ZC443.6 Source_evidenceePCR868WS150 Sequence/Annotation Release
Chunk_score Abs_score726
Max_abs_score726ZC443.6
Specificity_index0.922
Rel_score1
Map_statusUnique_ePCRV1282794912829123
K04A8.10 Chunk_score Abs_score61
Specificity_index0.078
Rel_score0.084
Overlaps_transcriptZC443.6 Source_evidenceePCR868WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC443.61175aacatcaatgtttggggtaagtgactctctaaactctttgtttagtattcaatgtattttcagtttattggaaacttcagtaaaactgcagcgtatcaaacagaatgtgagtcaattcacttcttgtgaaatcatatgcaatattttttagatatgttccaacaaactgaactgatcgaacaattacggaaggaaaaattcgatcttgccatcacagagtcacttttcttaggagcattcggtaattttatactgaaggaattatatatttttcataatttgatgcagtctgaaaaaaaagcagaatgtttcacaaaattacacatttgaatattttcagcacttttcgatgagatcggaattcggtctgtaattaacgctgattcgactctatacatgggaggaatgaaaggagctttaggagaacctgctgcaatttcttattatccaggacttttctcttcaattgacgacaaaatgaactttttcggaagagtcaaaaatgcggttgggtatctttttggactttggtttagtgttctgaaatatgatgacgaaattgtcgcttttccaaaaagttacaaaggatcaagagattggagagaacatttgagcaatgttgcattcaattttatcaattcaaatcagtatattgattatgctagtccaactcttccaaaaactgtttttgtcggtggaatgcaagtaaatacaaagaaaagtggaaaatcaacactttcaaaagaatggaatgatgttctttctctgagaaaaacaaatgttctagtctcttttggctcaaatgcttattcttctgatatgccagatgaattcaagtgagttctagaaaatttcgatgtttatatttctaaatttaatttttttttagaaaatcattcttggaagtatttgcatcaatgccggaaactacttttatttggaagtacgaagtggcaaatgcaacgttggtagatcatcttccaaatgttaaactgactacttggatgccacaaaatgatattcttggtaagtaatcgttattcctctatagtttcacaatttttcacatataaaattacagctgacgatcgactaacccttttcataactcacggagggcttggaagttctgtagagcttgcttatcaagggaaaccagcagttgttgtgagttt