Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC581.6   

sjj_ZC581.6RNAiJA:ZC581.6
PCR_productsjj_ZC581.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC581.6 Source_evidenceePCR877WS150 Sequence/Annotation Release
Overlaps_Gene ZC581.6 Source_evidenceePCR877WS150 Sequence/Annotation Release
Chunk_score Abs_score784
Max_abs_score784ZC581.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI66410896642524
Overlaps_transcriptZC581.6 Source_evidenceePCR877WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC581.61436cgttaccacctcgtcgtttttgacagctagctgaaaaataattcactgcagatctcatgatgtacttccaattgagaactatttaaaaataaactgactttgtgacaggactcctataattgtcttttttcctttaacatcagctattgcaccaccaccactgtcacccttcaaagaaatattaagtgacgcttgtgttttatttaaaatcagtattttcaaacttacaacacatgccactgttttatcagttatatctcttgcttggaaaaagtaaatttccatcggatgtgaacgaaaaacctcgattttctcatatctcaattgacctgtattatcgacaccgttttgattaatatcagaaggtgctgaaaagtacatttcaaatttaggagatatcaattgaaacatacgatttaatccgaatccaaagtattccaatgaaagtttatcattgggttgagtctcgtcatctgtaatttttagattttcgtcaaagaaattccacataaataaacaaatataaagaaattccacatgatggcaaacaaagaggcggagtcagaacataacttacctgcaacgcagactgattggacattacttgagaaagtcaactcttcgtataaatgaacaattgcaaagtcgtcagtataatattgtggtggaattttttttgtccgatttgctgttcgtttggtacatgcatgaacaagagttatcttctctggatatcttgatattccttttttgtttgagagaaattccactcttttgaggaattcttgattcgttattacatagtcactgcaagaaaagtctcgtggtatggttcaaaattttaaaaatttttagagacgtaggaaataatcttgaccatttgcctcaacttcttaaccaacctcagcaactttagaaatttcaatcgcaaaagtttcaagagtttggtacagtcggttaaagttgttatgacctttaaaaattttcagagaaaaattaccgatagtttgttaaacgtggtttaaaaataactaaaattgaatgagatgttgaggcaaattaccgagatgtaactatgaagtttggtctaataaaaggaaaacaaaacatataacaactaaaaacttactcatccttgcaattacttctatcaaatgtatcctcaataagattccatgaaccatctcggttttgcccggcgaaacagtgagtggcaatgagaatatgacgtggggagacaatggttcctgtgcaagttgtggcagattgctcgtctttactataaagatacgtgaacacagaccaaggtgcttccgattgtgatgcatcacgtccattatacacttttgctgaaaagggaatcctgagccagtaaagaatcatctcaagtatcttaaggaagaaaggaaactcacactgcaatggttttccacatg