Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZC64.1_b   

sjj_ZC64.1_bSequenceTTCAATATTTCGTAGGACCTCCA
In_sequence (6)
PCR_product (6)