Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZC64.2   

sjj_ZC64.2 RNAi JA:ZC64.2
[cgc5655]:ZC64.2
PCR_productsjj_ZC64.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZC64.2 Source_evidenceePCR571WS150 Sequence/Annotation Release
Chunk_score Abs_score466
Max_abs_score466ZC64.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX38404903842508
Overlaps_transcript ZC64.2.1 Source_evidenceePCR571WS150 Sequence/Annotation Release
ZC64.2.2 Source_evidenceePCR558WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZC64.22019tcggcaaaacattgaaacttactggaaattgttgtcgaaaacggcggaacacagaacacaacaatactgaaaagttttactgtccatattgtcagttttcaaaaaccgccctctttcggttcgtgcaataacagctctcataaaatgaacagtttcaaggcttgtcctccggtgaacaaagatcaaatgagaaaagtttcgtgagattcttctctttctcacctgggtggttttatttttctcaacaccacgtccttttcctccatattttctgatctgatatgcgtgatgtatccgttttccaaaacagaacaacagccagtgccaaacaacaaaaacaaaatgagtgcgagcgctttgaaatgagaagagaaattttactgattgcattcatggggaacaacttctaaataaaattcaaaatatttgatgtgaaatataatgaagaaaaaaattgtgaaagaaaagttaaatttaatcggtgaatttgaacttcaaatcatgggtctcttgtggaaactccaactccaaattgagaattccaaagtcatacacctttcttgctttgattccgagtgttacgtaatcttctggaagacggacaccaattcgtttgtagccgtactataaaaataattgatttttgtttcgtaagtgctggtctttgacttacattggatgtttgcttattgtccattccgcagttgtgatgaattgtgacatatggctggatatcggttttggtacgtgggaatctgaaagttaaacttataaaaacaaaattttaatcttaattccaggttttaaaacaaggcaattgctatcagctatttctgaaatgttgcagttgaacttagcactattttcgaggtcccgaaaattgctgaaaatctttggtttccttaaatctctccaattttgatgagaatcacaatttctatattttgtgtagagatttgaagtatcgaggagcttcccgaatgtttttctaaacccaaaaacctcttaacttttgataagattctaaggaccccaaaaaatgagtaagaatatattcattcagtgaaataaaagtttgtaattgttagaattgttcgtctgaattgctttttctatataagatactaaaaccagtcgatgtaatggtgaaaaatagcgagtgtgaaaacgattaaacattattgttctggagctaaaaaatgttttttaataacttcggaaaattatttatttcgagtcaaaaagttgtaaaacctcagtttacgcttatttagaaaaaatattccaaaacttttgaaaaacttcatttagatattcggtcagtttttggtcatatgaatgcgtttccattatttttcattgaccgtgctccacctttcagaacttgtattttcaaactgttctccaatttatgccactacaacaatgtgtaaaacttccttctcataatgttttcagcacaagataattctgacatacttcacttcatttcgaatgcacgcactattggcactattgataagcaagacatgaatagaaaacttttgactttttaaataaccttttctcagcaaaaaataacaaacctcgcggtacctccttcaacttggaacattcccgtaatgtatgtgttctttacgtcgagtagctcggcgagatctgacatgattatggtcttgctcaaaacttgataccttacttaccatctgctgcatttggttgaaatgttctgaaaagtcggatcttggctccttcgaaaggcttctttccacaatacagttgtcctttgactgccatggttctaaaaatataaattgatttttacaaaattgaaaattaaatttacctgttggcaatgttagttgggacatcaagatccgctccagcagaaacgtatgaaattggtaaaagaagagcggcgataaatatgaaaatcatgctgaaatgtgataattaaacgtatttctcagcgattcatgaatcaatagaaaggatattgaagaagataccggaaaacaa