Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1014.1   

sjj_ZK1014.1 RNAi JA:ZK1014.1
Simmer:ZK1014.1:Screen_A
Simmer:ZK1014.1:Screen_B
PCR_productsjj_ZK1014.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH15N14.2 Source_evidenceePCR1036WS150 Sequence/Annotation Release
Overlaps_Gene H15N14.2 Source_evidenceePCR1036WS150 Sequence/Annotation Release
Chunk_score Abs_score962
Max_abs_score962H15N14.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI77682837769475
Overlaps_transcriptH15N14.2 Source_evidenceePCR1036WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1014.11193cgattcagcgattcatcagaacgtccgaatgcctagaaattggggattaagaatataaatagaaaaatgattttttaccggtttgatatcattctcaagggcgtaatcaaaatcgccagaattaatagcaagtttctcaattgcatctggatcagcttgagctttacctccagccttcactagcctgttcattgcactggattgggcagctctgacgagaccttccaattcggcaccggaaaagttcttggtcctttttgaaatatcctccaaatccacgttggggtccattttattgtattctctcatgcgtgcagtgtgaattttaagaatttgaagtcgtccagtctcatcaggaagtgaaacttccatttggacttccaatcttcctggacgaagaagagcttcatcaatcatatcacgtctattggtcattccgattacaagaatattattcaattgttctactccatccatttttgagagcaattgattcacaacagtgtcatggactgatgagcttccagcctggaaattataaaggagtataatcgccatattgctagcaattataaaattcgatacttaccatagatcctctttgtttgcaaattgcatcaatttcgtcgaaaatgataatatgaagtcctgaatttgctccacaccgtctccattcttcttcggcatcagcgaacaattttctcacgtttgactctgattctccaacgtatttatccaaaatctgtggtccgtttacaatttttggctctctcgcgttcaacatctttccaatttgtctcgccatcaatgtttttccggttccaggtggtccgaacaaaagaatacctctgacgtgcttcattccgagttgctcaataaactctggtgggaatacacgagacgcgaaggcacggcggaaaatatgagaaaactcagtgtcaagacctccaattcccatttgttgaaagtcccagtcagggttgatgattgagcggtaagcggattttctgaaaaatgaatgtttttttattaatagactctaattcttaatactaaccctttactctttccaatcaaattaagcatagatccttcctctttatcaaatacaataactgaatttggtaaaagttctcctgcttcaatttgctttggtttggtggcactactgtccgtattggatgcaccacttg