Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1127.4   

sjj_ZK1127.4 RNAi JA:ZK1127.4
Simmer:ZK1127.4
PF:GL1_2A8
PCR_productsjj_ZK1127.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1127.4 Source_evidenceePCR819WS150 Sequence/Annotation Release
Overlaps_Gene ZK1127.4 Source_evidenceePCR819WS150 Sequence/Annotation Release
Chunk_score Abs_score756
Max_abs_score756ZK1127.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII70541007055016
Overlaps_transcriptZK1127.4 Source_evidenceePCR819WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1127.4917agcatatccaccatcggaagatgatcgtgatggtattgtgaacatgctcactcagacattcctaagaacagatattgacttgaaagcaatgtcagaaggaatcatcgctaaagcacctcatggagtcgtcttgactgtaagttttagtgcataattatgtagtctttaaaaaaacattttcagcaagcttacgacgatgaggaaaccgaagaagattatatggcttacgggttatgtacaacagttcctctcaatgataataaggatgatgctccaaagtttatcaaagacttattcacatatgttttgaatcgtgcaaagaaaggagctcctactgaaatttacaagaaaattgaagaaattcaagtttctggtgatggtaaatcggcgttgtttgtcaacgaaagacttctcaattttccgactattgtcgttcctcaaatctttggaagcattcgtgaagatttgtccggctttgaaacgaaatataaaactatcatctacatacagaaactgcgcattgttgaaactgatggatcagaagcaaaagttggcgccagctcaaacggatctagtggagtagctggaaaaaagaaaggaaaaatgggaaaagccgaaaagaagcgagctgctgcggctgcactagcaaatgctgaaatcgaattcgacaatccagaagatagagttctatttgaggtgaaataataaggaatcaactaaataattttcaatcgattttattttcagatcaaagaaggaaaagaaattcatttcgactatccagttcacatggatgtagagcctggaagtaaattccacagtaccgagaaggatggaaagaaatggaatccattccgtcgccttgtcatcatggatgacaaacgtttcgatgcatttttgaagaaaggatccgatgg