Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1225.4   

sjj_ZK1225.4RNAiJA:ZK1225.4
PCR_productsjj_ZK1225.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1225.4 Source_evidenceePCR986WS150 Sequence/Annotation Release
Overlaps_Gene ZK1225.4 Source_evidenceePCR986WS150 Sequence/Annotation Release
Chunk_score Abs_score881
Max_abs_score881ZK1225.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1321426113215443
Overlaps_transcriptZK1225.4 Source_evidenceePCR986WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1225.41183ttgtcatttccaggtgtccaaatgattcttatacgtgcccacatcttctctccagtctctgaaatatcattcttcttccctaaggtgtatccttccattcgtccgtgtgtatccttgttcaacttccagaatgtgtgcttgagctggtctaaaaatgtttttgaaataattttactttattagctctaaactaacacatatccgtccccttttccatctcctctccctttccagcgcaattttcaacctcatatgtaggacttgtcagcgctacaatagcttcggcgaaattgtaccacaactctggattgttaaccatcagttgaagtctggaattttataaaatgttgagtagaacttgaaaacctaactcacctcgatccaataatctcccgataaactaatgcgtgcttcttcatcaagtcagcctctggaactgcaattgttggacacatcacctcgaatttattgatcagccattctttgtccccatgaacatcctggaattgtaagattcaagtttatcaggccaaaacaagaccccaaaaagaccctacatatttgaattgcaacttaaaactgaattcctccgtcggatgaatatcttccgtgccaacatgtaccaacatggtcactctgaacacaagtcgatcgtaaactccaccagtaatttgtaccaatgtgtgttcattctgtaaaacgggaatctgtaattgcacaacttgggggctcaacttacttctcctttcaccggtcggcacatcatttggaaccattcccaccatttaataaaatccttctttgccattttcttcaactcagtcccgtgacaaacttcaattttgagttctttttctgaagcggaagaatagatccaatcaaatgggatttctgacactttttgctcagtgtaaaacaattcctgaagatgcttgagcaacttgtcccttgtctctaatctctctggatctagttcgtaaagatttgtattttcaaggcttactccaccatactctgtacatgcgccaacttcttcaatcttggtaagtgtgtagttactgtatttcttttcaccaagaagccgcatgtgaacaacataaatcatggttgcagagtatccccacgtagatttcgaattgaatcgtaccatgaacttgttgtaagcgttatcctcgattgggta