Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1290.1   

sjj_ZK1290.1 RNAi (5)
PCR_productsjj_ZK1290.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1290.1 Source_evidenceePCR627WS150 Sequence/Annotation Release
Overlaps_Gene ZK1290.1 Source_evidenceePCR627WS150 Sequence/Annotation Release
Chunk_score Abs_score522
Max_abs_score522ZK1290.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII75616247562778
Overlaps_transcriptZK1290.1 Source_evidenceePCR627WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1290.11155actgggaatattggaatggttctataagaagagtgacatgaatcatttttactagatcaatctgatatgcgtctttgggttttgacacttgttcaggcacattttgccattcttgcggttgcaggttagtttctaaggttcttctttgttcaactggcaacatttcagacactacggtggcagttgaagaaaccactaaagctgccaacgaaacaacgacacctgatggtccccatgccgactgctttctctgtgctcctacagtacaatgtggagaaacagttgaaggagactattcaagtggagaagttaatgtacttctaatgaaaccgatggaagataacgactattttattgtgaaaggagaagtattcccgaatgctatgaagtaagatattttcaaaatataataatcatgaaaatatagcatagtgcttcacattctagaattttcatcgacatctacaaggatttgtcagttggaaaagctcaagaaggcggaaacaatcagccgagacttctcacattcgaacactatttcgacacaaatttgacgttttctcgttccaatttacatggagaagtaccttttaatatatatttgttttcagattcaaatttatttcagggcgttccggactctttccgtgaggcaacattgccagatgctatcaaacaaaaaaaaccatggacgctgatgtttaagtaatcatcatttactaaagaaggtagaatgaatctagaacttttcagaatgaaggatggtttgagtgcatttgaaaccggagatgagactggatggttcaacaatgatattccatggaatggaaccgccacaactcaatccttcaatattcgaggtggatggaagactacttcaattcaatagtaagtctagaaccttctgaaaaagtttaatgctaaactttttcagtatttgtgtcaacagtaccctaccaattctatagaatgtgcgttttcataaataaagcataattccttgttcatttgttttttcttcatcatttctctccatgacgaccttctgtctgttatgtcatattcgcgcatttgattgctcatcaaactaattcgattatccgaagcgaaggttttcttctcgtttgtttggaaaggaggaacagaatggagaac