Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK131.8   

sjj_ZK131.8 RNAi [cgc5655]:daf-2:ZK131.8
[cgc5655]:tph-1:ZK131.8
[cgc5655]:tub-1:ZK131.8
[cgc5655]:ZK131.8
PCR_productsjj_ZK131.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK131.8 Source_evidenceePCR312WS150 Sequence/Annotation Release
ZK131.4 Source_evidenceePCR312WS150 Sequence/Annotation Release
ZK131.1 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene ZK131.8 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score Abs_score291
Max_abs_score291ZK131.8
Specificity_index0.309
Map_statusBest_ePCRII1381920713819891
ZK131.4 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score Abs_score291
Max_abs_score291ZK131.4
Specificity_index0.309
Map_statusBest_ePCRII1382264513823329
ZK131.1 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score Abs_score291
Max_abs_score291ZK131.1
Specificity_index0.309
Rel_score1
Map_statusBest_ePCRII1382537613826060
F22B3.1 Chunk_score Abs_score68
Specificity_index0.072
Rel_score0.234
Overlaps_transcript ZK131.8 Source_evidenceePCR312WS150 Sequence/Annotation Release
ZK131.4 Source_evidenceePCR312WS150 Sequence/Annotation Release
ZK131.1 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK131.8685aggcaatttcaatcagttcttcatctcacttgtgagtcttcatcaattgtcaacaatgtccggacgtggaaagggaggaaaaggccttggaaaaggaggagccaagcgtcatcgcaaagtgcttcgtgataacatccaaggtatcaccaagccggcaattcgtcgtctcgccagaagaggtggagtcaagagaatctctggactcatctacgaggaaacccgtggagtcctcaaggtgttccttgagaatgtgatccgtgatgccgtcacatactgcgagcacgccaagagaaagaccgtcactgccatggatgttgtctatgccttgaagcgtcaaggaagaaccctgtacggattcggaggataagtcctcttgcttccatgcaatctaccaaactaccgaacccaacggccctctttagggccacaaatattctgaatccaattatgaattgttcttttaataaatgtctttctttttacttattttgttttaaaatctttaacattttaaagctggaggtctgcagtacagactctgtactcagattcatatgtcgtcatagctcttcgattctatctgactatgatgcatttgatgacatcacgctacctgttttcagtagacagttataaaacaggtgcgaagacggactgtgttcccctctcaactcattatgacgtc