Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK1320.1   

sjj_ZK1320.1RNAiJA:ZK1320.1
PCR_productsjj_ZK1320.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1320.1 Source_evidenceePCR681WS150 Sequence/Annotation Release
Overlaps_Gene ZK1320.1 Source_evidenceePCR681WS150 Sequence/Annotation Release
Chunk_score Abs_score618
Max_abs_score618ZK1320.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII96565999657667
Overlaps_transcriptZK1320.1 Source_evidenceePCR681WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK1320.11069tacggatttttgtcttgcagatttccgttcgccgtgcccaaaaattcgaattaattttggaaaatgccaaaacttccacgtatcgacttttattttgacgtgatttctccgtacagttatattgcttttgaggttggttttttttatatacgatattacataaaaaactgtggttgtacgcatgtgtcgatggttctcttatcctaggaagtcaggaattttttttgaacagtgttacggtacaataatattttttagttttaaaattcgtaaatttattatagttatagaaattatgcaatgataaattgcaggtcttccaaaaactggaaacccaatggaaaggagtaacaatccgttacattccatttttcctcggagccgtcatgaaagaatcaggaaatcgtcctccagcaatgctcccagctcgatcaattatgatgatgactgatttgaagcgaactgcaaagttctgggatattccattgactccaccaccattgttcatggaatggatcaaaaagtaccgtactactggagcaatgaaggttttgttggttttgcaggagcaggataaggagctgatgctccgagcagctcgggaaatgtgggtcagattgtggtctcgaagtgagaagatttttgaggatcaagactttgtggaagtattgaaggcagttggtgttaagaatccggagcaaattgtggaaaagagcaaggatgagaaatatataaagattttgatggagaatacgaataagggagttgatttgatggtaagttattcatctttgaattaaaaaaaattggcaattttactttttcaggcatatggtgctccatggatcaatgtgcacacagaagatggatcggagcattcattctttggatcagaccgtttccatttgattgccgaccttcttcaacagccacaaccgcttccagaccgactttttggccagaaatcaaaactttaaatatttgttgtaagataagatgcgctaaatatatgaataaattgggtaaatatttttaattaactctctctgaaacagtctgacaatcgaca