Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZK1320.10_f   

sjj_ZK1320.10_fSequenceATAGTGTGGGTGGATGAAAAATG
Length23
In_sequenceSUPERLINK_CB_II
PCR_productsjj_ZK1320.10