Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK328.6   

sjj_ZK328.6RNAiJA:ZK328.6
PCR_productsjj_ZK328.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK328.6 Source_evidenceePCR877WS150 Sequence/Annotation Release
Overlaps_Gene ZK328.6 Source_evidenceePCR877WS150 Sequence/Annotation Release
Chunk_score Abs_score794
Max_abs_score794ZK328.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII60292666030421
Overlaps_transcriptZK328.6 Source_evidenceePCR877WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK328.61156taggtggaacaccatcgacatgagttccttgagaagctgtcatttgaatacttttaacaagattatcgacagtttcgatggaacatgaagatattctgaaagtgtccaatgggttgtaggagacaggagtggtaccgtcggcgaagagagaccaatctctgaaattatgggctcttgcattattattcatgaaaaaaacacatacctcatagtaatattctttgcttgaatattctgttccctcataacagcatacaactgatctaatcttagctgcggttgatcaaagtcagtacaaatgagcttgatcttgtagagtggcagggatggtaagttactgatctggttgagaatgtgcatcgatttttcggcatgtaattccaagttaatgtttgatttcgggtaacgaagaatgaaacttttcacaatttcaccaacgttcttgtagtaacgtggattcacatgaacttggagtgttagttgttggagttcctgaaaaagaatgtctgaaatgtaggtggaataattgcagaagctagggtgtttgcctaaagtctttatgtcttccttattattcttgcctgttgtcttgaattttgatgttcggtatttgtgaatgaatacgttttagtttcgaactgtgaaagcagacggacaaagccttacataaagtactcacactaaaaagtgtcccctcaattgcaaggaatcgttgagtaacatcgtcatctgggtgaatcatgagaagccacaagtcttcgacatttgaaaaataacgtctgccattatcctttgagacgtggatctgatcaattccagcgagaaagttgatatctgtggtcattttcataaaacttaaacgactgcgacggaatacaccagccaaaaaatcatgggaatccgaggggcagctgatcgaaagacggcggaaaggaacacattgatgggcttggggaaacattgatcccagctgaaatactcatttttctaatatttttaacataaaaaacataccctctcaatagagatctcgtgaatttcctttcgaaacttcgagttaattatattcgtccatcgcctgcagactctctccattttgcacaacaccggatagtcgtactggtcgaaaattttgcgaaggatcaagtccggcata