Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK337.4   

sjj_ZK337.4RNAiJA:ZK337.4
PCR_productsjj_ZK337.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK337.4 Source_evidenceePCR480WS150 Sequence/Annotation Release
Overlaps_Gene ZK337.4 Source_evidenceePCR480WS150 Sequence/Annotation Release
Chunk_score Abs_score438
Max_abs_score438ZK337.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1498409314985140
Overlaps_transcriptZK337.4 Source_evidenceePCR480WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK337.41048caaaaactcatttggcataaagctaccaggttcgtctgtttgcatgtattcgtttttaagtaacaaaaaatgacagaagaggtatggcttttaatcgaaagtttttgcaaatttttttattactattgtatcgctacaaaaaaatatcaggtaacagaattatcggtacttatacacaaaattccatctgtaaatgtttaaatgattgaatatttcgccatcgggatttcattgtttacctttcattttaagatatcactttttggtaactttaaaaaattttcacttatagctgctccgaagacaaacacaacctcacataagattaaacttttcagatattcgtgactattatataaaactaatatataaaaaatattacttatatgtacttgaactttcagcgagcctcaccttttcaacaactgtgtggcaaaaatgaaagttatgattttctggaaattcccgagggaacgtttgatgaaattgcaatgtccgaagatgatcaaatggaagttgcggcgtttgactcgatgtttccaaagcaatattttgatgatcttctggatgatgatatgggctatgaagaacctgaaaatgaagcaaacgttagagaaaatggtggagaaaccgaaaatgttgagaaaaaattggaggaaaacaaagataatgagggagcagcggaagaacaaaacgatcagcaaaaaaaagaagtcaataataataaccatagccaagaggtaattctttcattgattctcagctacggctgtttgttttgtgcccacgtgagcatgacaacgaacagttttcattgatttgcggaacccaaaaaaaatttgagagcgcgtttttgaattcttcaggttgtggtggaattttggcaaaccccaaagctgattttatttcaaaatgcaagaaatatgaatgatgttgtgtgggttttaagacctcgaattaagacctcgaacaaaagatcctcaaaaaattaaaatcaaaaaatcaaaaaatctctcatgttctcatttttggaaattcagcaatcact