Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK354.11   

sjj_ZK354.11RNAiJA:ZK354.11
PCR_productsjj_ZK354.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK354.11 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (36)
Overlaps_transcriptZK354.11 Source_evidenceePCR438WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK354.111075aattgagctttctattgtgcctggtggagtgaggtgagacaaatcagcgtctttaaaattcactcgcttcttctgattgattgaacagtatggggcgcaaatctctgattggttttgcagttcttatttttgaggaagtttggatgataacggttttttcattcttcctcaatgtgttttgtttttcttttgtagtttgttttgtagaatttcagattatgtttgagattttgaagtcaattttcacgatactgccacatataggactcgaagagtatattcaacaattaaaaaaacttttcatacaaataagatcgatacgattattttccatcaatataccttctattttaactcggactttgaatgagtttgtagattttgatattggaacaataagaaattgacccctgtcttgggttgaaaaggtgcaaagacagagagtttcaactaaaacattaattcctcaaaaaagcttcatcaaaataaaaagtgagccaagccttctttgggttgtactcgattggaaggtggcctccacctccaccaaatttgatacgcttttgaatctgaaaattttaaccaagagaaatacaacgatctttgaaaattcatttattgaatgaaatagcacagggctctatgggttgtactcgatagggaggttcttgcgacgaaccataccgtctccttggaaccattcacggcggaattgcttggcagctccatccggggtgttggtccactcaacagtgatacgatcgttgttggtgtcttcttgtccaaaggcgaaagcatcacaggaaacggcaagaagaactgcttcctttgggtcgagaactccacatggtggatcaactccaagtctcttcatattggtggtcttgataccgtatccaatacggcgagccgatgagttgatcaccttgatgtggtaggtgtgcttgtcatcgtatggggcattgaagacaatcttggtacccggctgggtttggatgtctcctggtgggacagattgggccatggcgacttgttgaaggagttatgagaactcgcagtgaagattatgacaaaa