Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK384.4   

sjj_ZK384.4RNAiJA:ZK384.4
PCR_productsjj_ZK384.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_GeneZK384.4 Chunk_score Abs_score708
Max_abs_score708ZK384.4
Specificity_index1
Rel_score1
Overlaps_pseudogene ZK384.4 Source_evidenceePCR729WS150 Sequence/Annotation Release
Map_statusUnique_ePCRV1873970418741399
WB_DNA_textsjj_ZK384.41696aatttcagacatttgcgagagagaataaaaattttttagtcatttttagatagaaaagtcaaaatttagacgtttttacaatggaaattcaaatttcaaacagttttgccgaagaaattgagattttcaggcatttttacatgtgaattttagaatttcacacattcattttcacccagaaaacatattaattataaattttccgttatgtaaattttccgttatgtctcaccatttcttcaattatactctcttagtcatttcttcaacattctgaaagcgggtaatcgtatattccagttttagtggattcatttccaaagaagtgttattactccgttttctgtaaggtaaattattcaaaaccatcagcaaagttataaaattgccaagtatcatttaaaaattttagaaaacttgaaaattttggaggcaaaacgttcattttgttttcattatttcacacaattttgcctacggaaatgggattttcattttaaaaaatttcaaaatttcagccaaaaacacattttcagataaaaaattcaaaatttctacactaaaaaactcaccaaaaagatcgtcaaaatccagcaaaaattcattatagaaactttaaaaaatcaataaaacatccggaggacaccacacaagcgtccagaaaaagtcgaatgagtgagagttgtgtgctccgcgagccctaagcttatcagttaagaaatagcactgaaaattggggacggaaaagaaaattgttgagtaagtgctctgacacaaaattgcagagcatttcggccagaaagcaaacatcgaaaaaaaaaatcaaaattggcaatttcagaaatttcctatgtaaaaatgcatgaaatttcgtattttctatgaaaaaaatgtctgaaagtttgattttccggtgaaaaaatgtctgaaacttccaatttacaatgtaaaaatgtatgaaattatgaattcccaatggaaaaatgtatggaaaattgaatttccagtgtaaaaatgcctggaattataaatttccggtgtaaaaatatctgaaattacgaattttctatgtaaaaatgtcttaaattgcgaatttccaatataaaaattgtgtgaaaattcgaattcctttttaagaatttctgaaattttgaatttccagtctaaaaatgcctgtaatttgaacttccagcgtaaaacgttcttaaatttcttaagtttcctatataaaaatgtctgaaactatgaatttgccatataaaaatgttttaaatattgtaattactattgaaaaattatctgaatacctgattttttatatttgaaaatatctgaaacaccgaattttgtatgtaaaaaactctggaactttgaattttctgtgagaaacttcaataaacttatcaattcccaatgtaataattgctaaattttcaatttccagtctgaaaatgtctgaaatttcatagtttttcaatttctaaaatttagatttatcctatcttaaaatatctgaaatccaaattttaagagcagaaaactctagaattttgaattttttggaatataaagttatgatctacccaaaagactagcagtggtctcttctgggcccgctagtctctaagccgttggcctattttttcactggaataccgaagacaatttttcaaagttttagtgcatgtcgtctggt