Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK39.1   

sjj_ZK39.1RNAiJA:ZK39.1
PCR_productsjj_ZK39.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW02B9.1b Source_evidenceePCR706WS150 Sequence/Annotation Release
Overlaps_Gene W02B9.1 Source_evidenceePCR706WS150 Sequence/Annotation Release
Chunk_score Abs_score643
Max_abs_score643W02B9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1112853911129710
Overlaps_transcriptW02B9.1b Source_evidenceePCR706WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK39.11172gaaatctcgagccaagcatcggatctttgttttttctggtttcgggcgaccacgtggatatggtaggtaccgtaacctactgggagtacggtagaaactcggccagagaattgatcaattttgaaaaatcgggatggctcttcaaggtgaaagaggaggggctccgagaggtttctgcaaaaaagagatgttgtagtttgtagtgtagactgcagactacacgttttgagtgaggctataaaattgtgtagtttgtagtttgtagcctaccttttttccacgtcaaacaccgttgaattggccggaattgcagatgcgaactttgcgatcgattttttggatttcagcagaaaatgcacatctccagagtcgataacgtcaatgatcactttggtttgggcaatctgaaattataaaaatcgatattttttaagttttaacactacaaactacaaaaaagtttagcctcaggtaaagttcgaggccaaacatttggttgaggctaaactaaaattgtagtttgtagtgtaaggtttgtttgtagtcgacaaagtgttgaactacaaactacaaactacaaattataacctacaaactacaaacatcctacttgtaagccatatccccttcccatttcacctggctcctcaatgcaaattttcggtttgtagttgtagtttttattttgtagtttatagcttaatgtttgcagtttgtagtccacaaattttcaagtatttaaatactacaaactacattattttcgacacttgccatttcccctgtcttctctgtaaatgctccgagaaaaataacgtggcgcgtgatgtcatcctcctcaagcttctgcttcatcatcacaatatcgactgattttccacgtgtcatcacggaaaacggactgctgtatttactgattttatcgattttcgaaattggagaaatcacgaaatttttccgattcctaactgtaatcggcttcgagaaaactacagtactcccgggctgctgtgacgtgtatacggtagcatggtatacggtagatagaaaagttgccggctgctgggatgtaccacgtggatctacatagacgtggagagttaccaggcgttggaaattttgctcttttacgttcaaaaatagttcgaagagctctccgtggaattgggtta