Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK484.3   

sjj_ZK484.3 RNAi JA:ZK484.3
PF:GL1_1H3
PCR_productsjj_ZK484.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK484.3 Source_evidenceePCR841WS150 Sequence/Annotation Release
Chunk_score Abs_score778
Max_abs_score778ZK484.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI60690266070207
Overlaps_transcript ZK484.3.1 Source_evidenceePCR841WS150 Sequence/Annotation Release
ZK484.3.2 Source_evidenceePCR839WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK484.31182aaacgcatttgcttctcgttctccagatattgtttggttggttttgtcgagagttttggaacgactggcttcttctttttcttcgcagctgctgcggcggcggatgaatcagatgtggaggtgacatttgtggtagttggtggtttcttcgagatagccttctgcaaaatttatggttaaaaaattatgtaaattatgttctcgaaactttttccagcagactgaaaagtcagatatgcaaataaatgtcgcttcgctgttatttatatcaaaaataaatgaaaaatctgataaatgtttaccttcttgacaaccttcttaactggctgttcagccttagtctcttccttcttcacaattgtagcattcgtggtagttggtgtagtggttgcagatgtagttgcctcagcagttggaacttctggaacagctactggaaccggagcagccgaagaagtgagttctgctggttcagaggatggagtcttgattgtgactttctttgccttaacagcagatcccttcttctttggagtagtcgaatcggcttctgaagaggttgacggaaccgatttcttgatcggagctttcttcattgaagtaagagttgctgcagctgcggcagctgctgcaagagcctttctctcggcatcacgttcctttttcgatgggattgttctcttcttttcgacaactgggactggtgccggcttgttcttcggcttaatctctttcttgacaggagctggagctgaagccgaggcagtggatgaagtagaagggactttgattccttgctgattcgcctcattaagagaagcgcggagaaccatttcgagctcatggcgatcgaatctgaaaggtaaatcgtttttttatttgtaaataaaaatggattaatttgaaattctaaaatttctaaatttcatatcaaatttcgccgtttcttttaaaactatgaagaggttacgcacccttcttcatattttcccatttcaattctctgtcttcctgatctacgaattcccgaatcttcgggactcggtgacttttcaactttcttcacacttttcttcggcgctgcctttgctttcgccatctgcaaaaaaattcgtgagcaattaaaaaaataattaataaaaatgcaaatagatattcaaaacggcacagaaaaaccaaatt