Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_ZK507.3_f   

sjj_ZK507.3_fSequenceGTTCCTTCATCGAGACATCAAAC
PCR_productsjj_ZK507.3