Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK546.6   

sjj_ZK546.6 RNAi JA:ZK546.6
Simmer:ZK546.6:Repeat_a
Simmer:ZK546.6:Repeat_b
Simmer:ZK546.6:Screen
PCR_productsjj_ZK546.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK546.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (32)
Overlaps_transcriptZK546.6 Source_evidenceePCR455WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK546.6847tcctggagaaaaattgatttgaataagatttctgaaatcataaatgcagaaaattgaagtcgtcagaattttcacggatttcaaaaatcattttatttatttattaacttttggaactttatttgacgtggctattgtaaagatctaggacaaagataagagagaaatttgctataaattgagcaggttttgtcataaacttcactgtgagttttaactcccaatcaagaagtcgccatgacccaatccgtcccaccaggagacatccagacccagccgggtacgaagatcgtcttcaatgcaccatacgatgacaagcacacctaccacatcaaggtgatcaactcatctgctcgccgtattggatacggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctggacccaaaggaagctgtgcttctggcagtttcctgcgatgccttcgcctttggacaggaggacactaacaacgatcgtatcactgttgagtggaccaacactccggatggtgctgctaagcaattccgtcgggaatggttccaaggagacggtatggtccgtcgtaagaacctcccaattgagtacaacccataggatctgtgaacttccaaaatttcaataaattttcattgatagttcgttttttgtttttttacttgaacagattttcagagattttcaaacgagataatattgtcatgctcgaaaaaagagcttcctttccactagtttgagcattttcctctggattagctggctcgacactgcaatgtttcttcgatcagttcttttaaaaaaaccgaactttaacatttctgca