Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK593.3   

sjj_ZK593.3 RNAi (5)
PCR_productsjj_ZK593.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK593.3 Source_evidenceePCR444WS150 Sequence/Annotation Release
Overlaps_Gene ZK593.3 Source_evidenceePCR444WS150 Sequence/Annotation Release
Chunk_score Abs_score402
Max_abs_score402ZK593.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1091628110917798
Overlaps_transcriptZK593.3 Source_evidenceePCR444WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK593.31518ttatcgcaccaactgatctttttctttactcctacgaattttagatccaaatttttgataactatttttctattgtcatggctttaccggtcaccttttcagatgacattgaccctttgaatagtataaagaggacttgtaaggctattcattcgaccagtacgcgttatttttcagtgcgctggcccgaaaaatccaatatttttgtttttattttccatccgcgctttttgtgtgaagtttatttgttcatcggtcagccataaccaactcattttatattttcagtcattcgttaatcaaaatggtcgccgttatgctcccaacagctcgaaaaccaactgaacataaaactccatcagctattgatcaaaattggccgtgttttatcgttgcattcacaatggcatcaatcaagcttttgctctcatatactggaacagaagacttcagaattgttggattcagtaagttatagtatttggaaacaaaggacaatgataaaacaactccttctgggaaattctagggttaaaattcaaaaacaaaaaattattacgaactatacaaattattttaattttgctaaatctttcgcacttggtgtatatcctgagagttttcgactcaaatgtggaacgacaaagaaaaatattaggcgaaaaattttcagtagtcaggtggaactaggtggaacaaaagttttgccaacataccgtatattctctattagtggggcaccccttcgctcaactttgacggatttgccaatttatgaattcaagttgcttttttcggccaaacttttagacgaaactgcccctaaatgccgagattttggagtaaactccttttttttaattatagcgctgtagcatatgccggttaagtttgctctatacagacaagtagacagatatgttttgcctacataaaataattttcctaatctggcattaactactgaatttcagatgatgtcaacgtattcttcctcatggaacttggctcaactccacttgcagtcataaatccacgtgtctggtttggaatgtttatgtgttctctttcatacatgtctgtggagactggatatccaactgtcgctattgtcactattgtttcaatgctcattattgcctacgcaatggagtatgtcgattatagaaagaagcaagaaactgagagaaccgctgtctaccaaattcttccacttgtcgatgagaagaagttcagagaacaagaaatgatctaacaatacttttcgtgtttctaaatgcttattttagtcaaattgactcaaactcgagtgattttatcaaagatttcaaacttgtattttatgcctcattttcacattctggtttttcttgtaattaaggtactaaactataaaactatatattttattgactcttttcatattttactattggatatgtatatcaatattaaaccctcataaactaaacataattgtctattttagagttgaagccaacattctctggtgtgtat