Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK809.3   

sjj_ZK809.3 RNAi JA:ZK809.3
Simmer:ZK809.3
PCR_productsjj_ZK809.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK809.3 Source_evidenceePCR666WS150 Sequence/Annotation Release
Chunk_score Abs_score540
Max_abs_score540ZK809.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1165216011653308
Overlaps_transcript ZK809.3.2 Source_evidenceePCR639WS150 Sequence/Annotation Release
ZK809.3.1 Source_evidenceePCR666WS150 Sequence/Annotation Release
WB_DNA_textsjj_ZK809.31149gggctttttaataaatggcagatctaaatttaactgcaaaatagtttgttttattcaaatttgctaaaattttattgatttcgtatgtaatttatgttaaattgttatatttcgttgtcatgtatcatgttttttgtgtgcccgttcattattatcgatttttactcagtttatatttaagcagtctcacaaattcataaaaacgaatttcaggctcaaatgggtaaccagtatgtgaaaccagaacgcacgggcaattccccttatacccggtccggagttccaccaccggcgcttgtcaagactggtgacaagcctcttcacaggtaattcttttagattctgttcaacaaattctattcaacacaaaaaaattcagagtgaatgaccgcatgtctctcgagctccacatggccgatgagcgtgttcgtgccgctggtttgagcccagccgaaagagaatggagaaagaagtgggttcatgtgagtttttacattttttgtcaattgttaatactaaaatgtttatgtttaggaccagcaccttcacgctgacgagccagtcgttgtcgatgccgttcatcgtcagttgaacccaatcagaaccgcttacagacttccatgggacaagttctatcttcattacctcaaggtgagatatattttctttaaaaaaatcaattttttaatttgaatttctcatttattgcatttcagccaacattcggagtttactatggaaccgctatcagagttacagctccaaaattgctcatggctttcgtcgttgtgcagactgcctattattattggaaatacgaagtcaaggtattcaattttttgaattttatattaatttcacgaaccattatcttttcaaggactggacacatttgagaggacttgaatcgatgccacaaaaagaagttattgctagtgctccagcaattgaagagaaattccctggactcatggataagggactcgccaacccatccaaggatgactactacacgtgagttaaacaataatttgtggaatattggaaaattgaaacttttcagaccaacatttaataagcgtactgcttacctcgatgttggagagacaaaacgaccgtggtaatcgaaaggaaacgagtgacaatcag