Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_ZK863.6   

sjj_ZK863.6RNAiJA:ZK863.6
PCR_productsjj_ZK863.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK863.6 Source_evidenceePCR504WS150 Sequence/Annotation Release
Chunk_score Abs_score462
Max_abs_score462ZK863.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1219375012194683
Overlaps_transcript (3)
WB_DNA_textsjj_ZK863.6934gtctcttcgtctcaacaatgcttgcactccgtcacattttcgaattgtcggccgatatcggtatttagataaattcagtgctctcctttttttctccattttactttcatcaatcttttttaaaaatcaatattcagcaaactattgaaaaattaattcaaaaaacacgactggtcggaagttatttgcataatcaatagaaatttcgttttccgctcgctgtcagtgttttgtcctgtttgtatttcccagtgcacttttcgagtggctcaagtttttatctattttcctgcaaacttgcatatattgttttcttccagaagcctttgatatctcaataattttatacttgtttcagaaatcgagcaaaaaccaagatggctgatcaaaccgcgtctgccgaggttgctgtaagttattaaagtccattttctattttactgggaaacaatattcaaaataatgtattcaacacatttgcaattttagaccgagaagatggacactgctgaagctccagctgctgccccagccgcatctgcagccgctccagcggaagcagagagcaacgagaatacgacagttccatcaaacgtcttgtctgccaatggaggacaacagactggtaatcaatcggcaccgcgcaacacaagtactgttccaactcgtcaatatctcgactcaactgtcgtaccaattcttctgcaaggactcggtgctcttgctaaggatcgtccagaaaatccaatcgaattcctggctaacttcctgttgcgcgagaaagaccgttacaacgctgagaatcaaaacccagccggccaacaataaacattaaaatgacacatattgtgtgaagaaccggcaatattcccttctaattttcgtatattacattttgtaacttattcgtattccttcaaatttaatctgccac