Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_K03A1.6_f   

smd1_K03A1.6_fSequenceggttggttgtatgaaatcgagag
Length23
In_sequenceK03A1
PCR_productsmd_K03A1.6