Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: smd1_Y75B12B.9_b   

smd1_Y75B12B.9_bSequencetccaactgacgatcctactttgt
Length23
In_sequence SUPERLINK_CB_V
Y75B12B
PCR_productsmd_Y75B12B.9